Here is an example of the submission for the cloning assignment.

I keep working with my old friend human TNF.

picture showing the results of a restriction mapping of TNF

Restriction mapping of TNF

This is the restriction map obtained using Nebcutter. I can submit the figure, or alternatively I can save the list as a .txt file by using the List function (only 1 cutters). However I will spare you the long list, as none of those sites is useful for me.

The vector I am interested in is the p-CLIP vector. This is a vector that has a CLIP tag, and one can insert the gene of the protein of interest either before or after the tag, so that means that one can have the protein tagged either at the N or at the C terminal. This can be  useful for many reasons, but in the case of TNF, as it is cleaved closer to the N-terminus from the proform to the soluble form, either tagging could give information fo what happens to either product.

Here is the official description:

pCLIPf Vector is a mammalian expression plasmid intended for the cloning and stable or transient expression of CLIP-tag® protein fusions in mammalian cells. This plasmid encodes CLIPf, a CLIP-tag protein, which is expressed under control of the CMV promoter. The expression vector has an IRES (internal ribosome entry site) and a neomycin resistance gene downstream of the CLIPf for the efficient selection of stable transfectants. pCLIPf Vector contains two multiple cloning sites to allow cloning of the fusion partner as a fusion to the N- or C-terminus of the CLIPf.

The CLIP-tag is a novel tool for protein research, allowing the specific, covalent attachment of virtually any molecule to a protein of interest. The CLIP-tag is a small polypeptide based on human O6-alkylguanine-DNA-alkyltransferase (hAGT). CLIP-tag substrates are derivatives of benzyl cytosine (BC). In the labeling reaction, the substituted benzyl group of the substrate is covalently attached to the reactive cysteine of CLIP-tag forming a stable thioether link.
pCLIPf contains an improved version of CLIP-tag, termed CLIPf. CLIPf displays faster kinetics in in vitro labeling and fast, specific and efficient labeling in live and fixed cell applications, thereby rendering it a desired research tool for analysis of protein dynamics.

And this is the map:

figure showing the cloning vector's genetic map

p-CLIP vector

I am interested in following the cleaved soluble TNF, so I will use MCS-1 to insert the sequence (that way the CLIP tag will be on the C-terminus). Here are the enzymes involved:

restriction sites of the MCS1 of the pCLIP vector

Restriction sites of the MCS1 of the pCLIP vector

 I run the Primer Blast and I get several recommendations for primers. At the first try it will give me a pair within the sequence, so I have to set a range of 140-200 and 890-940 for the forward and the reverse primers, respectively.The primers provided by the program were:

Forward primer  1    CTCCACCCTCTCTCCCCTGGA  21
Template        140  …………………  160
Reverse primer  1    ATTGGGGCAGGGGAGGCGTT  20
Template        916  ………………..  897

(Practical observation: restriction enzymes are expensive, so most labs will have a modest collection of the “workhorses,” which are such as EcoRI, BamH1, Xho1, HindIII, and some more. So often your decision as to which enzyme to buy will depend largely of which are already in the lab freezer. EcoRI was a no-brainer for one of the sites, and I chose EcoRV because it was a short sequence and easy to insert.)

PCR primers: Forward: GATATCTCCACCCTCTCTCCCCTGGA (with EcoRV site in bold)

                           Reverse: GAATTCATTGGGGCAGGGGAGGCGTT (with EcoRI site in bold).

Note: in real life I would have probably added some more bases just in case before the restriction sequence, and would have run some simulation runs in a software to optimize the primers’ parameters regarding length and added sequences.

Advertisements