Cloning assignment

Leave a comment

Here is an example of the submission for the cloning assignment.

I keep working with my old friend human TNF.

picture showing the results of a restriction mapping of TNF

Restriction mapping of TNF

This is the restriction map obtained using Nebcutter. I can submit the figure, or alternatively I can save the list as a .txt file by using the List function (only 1 cutters). However I will spare you the long list, as none of those sites is useful for me.

The vector I am interested in is the p-CLIP vector. This is a vector that has a CLIP tag, and one can insert the gene of the protein of interest either before or after the tag, so that means that one can have the protein tagged either at the N or at the C terminal. This can be  useful for many reasons, but in the case of TNF, as it is cleaved closer to the N-terminus from the proform to the soluble form, either tagging could give information fo what happens to either product.

Here is the official description:

pCLIPf Vector is a mammalian expression plasmid intended for the cloning and stable or transient expression of CLIP-tag® protein fusions in mammalian cells. This plasmid encodes CLIPf, a CLIP-tag protein, which is expressed under control of the CMV promoter. The expression vector has an IRES (internal ribosome entry site) and a neomycin resistance gene downstream of the CLIPf for the efficient selection of stable transfectants. pCLIPf Vector contains two multiple cloning sites to allow cloning of the fusion partner as a fusion to the N- or C-terminus of the CLIPf.

The CLIP-tag is a novel tool for protein research, allowing the specific, covalent attachment of virtually any molecule to a protein of interest. The CLIP-tag is a small polypeptide based on human O6-alkylguanine-DNA-alkyltransferase (hAGT). CLIP-tag substrates are derivatives of benzyl cytosine (BC). In the labeling reaction, the substituted benzyl group of the substrate is covalently attached to the reactive cysteine of CLIP-tag forming a stable thioether link.
pCLIPf contains an improved version of CLIP-tag, termed CLIPf. CLIPf displays faster kinetics in in vitro labeling and fast, specific and efficient labeling in live and fixed cell applications, thereby rendering it a desired research tool for analysis of protein dynamics.

And this is the map:

figure showing the cloning vector's genetic map

p-CLIP vector

I am interested in following the cleaved soluble TNF, so I will use MCS-1 to insert the sequence (that way the CLIP tag will be on the C-terminus). Here are the enzymes involved:

restriction sites of the MCS1 of the pCLIP vector

Restriction sites of the MCS1 of the pCLIP vector

 I run the Primer Blast and I get several recommendations for primers. At the first try it will give me a pair within the sequence, so I have to set a range of 140-200 and 890-940 for the forward and the reverse primers, respectively.The primers provided by the program were:

Forward primer  1    CTCCACCCTCTCTCCCCTGGA  21
Template        140  …………………  160
Reverse primer  1    ATTGGGGCAGGGGAGGCGTT  20
Template        916  ………………..  897

(Practical observation: restriction enzymes are expensive, so most labs will have a modest collection of the “workhorses,” which are such as EcoRI, BamH1, Xho1, HindIII, and some more. So often your decision as to which enzyme to buy will depend largely of which are already in the lab freezer. EcoRI was a no-brainer for one of the sites, and I chose EcoRV because it was a short sequence and easy to insert.)

PCR primers: Forward: GATATCTCCACCCTCTCTCCCCTGGA (with EcoRV site in bold)

                           Reverse: GAATTCATTGGGGCAGGGGAGGCGTT (with EcoRI site in bold).

Note: in real life I would have probably added some more bases just in case before the restriction sequence, and would have run some simulation runs in a software to optimize the primers’ parameters regarding length and added sequences.

My favorite orthologs

Leave a comment

Human TNF

This human TNF gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. This cytokine is mainly secreted by macrophages. It can bind to, and thus functions through its receptors TNFRSF1A/TNFR1 and TNFRSF1B/TNFBR. This cytokine is involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. This cytokine has been implicated in a variety of diseases, including autoimmune diseases, insulin resistance, and cancer. Knockout studies in mice also suggested the neuroprotective function of this cytokine.

For a recent review of the human TNF superfamily see Aggarwal et al, 2012.

TNF superfamily members include the cytokines: TNF (TNF-alpha), LT (lymphotoxin-alpha, TNF-beta), CD40 ligand, Apo2L (TRAIL), Fas ligand, and osteoprotegerin (OPG) ligand. These proteins generally have an intracellular N-terminal domain, a short transmembrane segment, an extracellular stalk, and a globular TNF-like extracellular domain of about 150 residues.

TNF superfamily structure

They initiate apoptosis by binding to related receptors, some of which have intracellular death domains. They generally form homo- or hetero- trimeric complexes.TNF cytokines bind one elongated receptor molecule along each of three clefts formed by neighboring monomers of the trimer with ligand trimerization a requiste for receptor binding.

Orthologs

TNF is highly conserved among mammals, with over 90% homology in primates. It is highly homologous to the murine (mus musculus TNF, accession number NP_038721.1), showing a 79% homology.

An initial search for orthologs did not bring many hits. I kept combing the literature and found a reference to a molecule called Eiger in Drosophila and another reference to a TNF-like molecule in the sea urchin. Then I kept mining and found references to TNF in fishes and amphibians.

<I have to make a philosophical pause here. Scientists are usually very specialized in their fields, a necessary requirement. Specialization comes often with complete blindness to other disciplines or areas. So I confess that during all my years of researching TNF I did not look further than the “TNF is highly conserved in vertebrates” mantra, so focused I was on human TNF and human diseases associated to TNF. It was only when writing my thesis that I ventured into reading more in detail about other organisms, as many mechanistical details of TNF pathways came from comparing immune pathways in different organisms, particularly in Drosophila. So I am glad to say that although I chose TNF as an example of this assignment because I thought it would be slam-dunk to prepare, I have actually learned a lot of cool information that was new for me.>

Finally I have arrived to this article by Wiens and Glenney, 2011, which I just ordered through ScienceDirect, so I do not have access to it…but here is what the abstract says:

The tumor necrosis factor superfamily (TNFSF) and the TNF receptor superfamily (TNFRSF) have an ancient evolutionary origin that can be traced back to single copy genes within Arthropods. In humans, 18 TNFSF and 29 TNFRSF genes have been identified. Evolutionary models account for the increase in gene number primarily through multiple whole genome duplication events as well as by lineage and/or species-specific tandem duplication and translocation. The identification and functional analyses of teleost ligands and receptors provide insight into the critical transition between invertebrates and higher vertebrates. Bioinformatic analyses of fish genomes and EST datasets identify 14 distinct ligand groups, some of which are novel to teleosts, while to date, only limited numbers of receptors have been characterized in fish. The most studied ligand is TNF of which teleost species possess between 1 and 3 copies as well as a receptor similar to TNFR1. Functional studies using zebrafish indicate a conserved role of this ligand–receptor system in the regulation of cell survival and resistance to infectious disease.

I need to show this- a comparison of the vertebrate and the amphibious immune system, copied from Huang’s article. See TNF to the left of both.

Slide showing a comparison between amphibian and vertebrate immune systems

Comparison between amphibian and vertebrate immune systems (from Huang et al, 2008).

Well, I have to stop here…but I hope you see my point of the importance of narrowing down your topic, as it always expands as you start digging!

I hope you undertand a bit the point of the past 2 assignments: we are looking for a protein related to a function. The structure of the protein is often related to its function- and we have had the chance to see different proteins, from transcription factors to toxins, enzymes, and hormones. Take a pause and look at the function- how specific it is? That will relate directly to how conserved that gene is going to be- you would expect a protein involved in some essential and widespread metabolic function to go back earlier in phylogeny compared to a protein associated to a more specific function. In my particular example, TNF is part of the immune response, so it is mainly described for vertebrates particularly mammals. But as you see from the abstract above, you see the beginnings going back to Arthropods.

Conserved features

Trimer interface, which is a conserved ring of hydrophobic residues; aids in self-assembly of monomers.

Receptor binding site. TNF ligands share a common structural motif, the TNF homology domain (THD), which binds to cysteine-rich domains (CRDs) of TNF receptors. CRDs are composed of structural modules, whose variation in number and type confers heterogeneity upon the family. Protein folds reminiscent of the THD and CRD are also found in other protein families, raising the possibility that the mode of interaction between TNF and TNF receptors might be conserved in other contexts

Quartz

Quartz is a digitally native news outlet for the new global economy.

WordPress.com VIP: Enterprise content management platform

Our fully managed cloud platform, expert guidance and support, and diverse partner ecosystem free you to focus on your business objectives.

gplusmicrojc

Site for our Microbiology Journal Club on Google+ Hangouts

barralopolis

Teaching and learning reflections around science education

Disrupted Physician

The Physician Wellness Movement and Illegitimate Authority: The Need for Revolt and Reconstruction

Tanya's Blog

Tanya's ramblings on science, education, and other miscellanea ...

The Blog of Author Tim Ferriss

Tim Ferriss's 4-Hour Workweek and Lifestyle Design Blog

Here is Havana

A blog written by the gringa next door

Storyshucker

A blog full of humorous and poignant observations.

Small World Initiative:

Crowdsourcing the Discovery of Antibiotics

Jung's Biology Blog

Teaching biology; bioinformatics; PSMs; academia, openteaching, openlearning

Mr. Heisenbug

Respect the microbiota.

blogruedadelavida

Reflexiones sobre asuntos variados, desde criminologia hasta artes ocultas.

Humanitarian Cafe

Think Outside the Box

Small Pond Science

Research, teaching, and mentorship in the sciences

Small Things Considered

Teaching and learning reflections around science education

The Loom

Teaching and learning reflections around science education

LightCentric Photography Blog

Musings on Photography and Life